 |
 |
|
|
| Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
| hsa_circ_0052112 | |||
| Gene | ZNF83 | Organism | Human |
| Genome Locus | chr19:53158813-53164096:- | Build | hg19 |
| Disease | Breast Cancer | ICD-10 | Malignant neoplasm of breast (C50) |
| DBLink | Link to database | PMID | 30257349 |
| Experimental Method | |||
| Sample Type | Cell Lines | Comparison | Human breast cancer cell line MCF-7 and MDA-MB-231 were purchased from the Cell Bank of the Chinese Academy of Sciences |
| Method for Estimation | Quantitative PCR | PCR Details | |
| Primers (Experimented) | Forward AGAGGGCTTTATACAGGGCC ReverseCCCTGAAAGTCAAGCATCCC | Statistics | Fold Change : Upregulated pvalue : p<0.05 |
| Citation | |||
| Zhang, HD, Jiang, LH, Hou, JC, Zhong, SL, Zhou, SY, Zhu, LP, Li, J, Wang, DD, Sun, DW, Ji, ZL, Tang, JH (2018). Circular RNA hsa_circ_0052112 promotes cell migration and invasion by acting as sponge for miR-125a-5p in breast cancer. Biomed. Pharmacother., 107:1342-1353. | |||